activity7 | Biology homework help

Lab 10: Paternity Testing with DNA Fingerprinting

Name: ____________________

Introduction

DNA “fingerprinting” is a powerful tool for comparing two DNA samples. The process is relatively simple. This exercise should help you see how this tool can be applied to forensic and paternity testing.

The Case: A married couple, Joe and Sally (Sally is infertile), arranges with a close friend, Mary, to have a baby. Mary is artificially inseminated with Joe’s sperm. When Mary gives birth to the child, she decides that she wants to keep it. She claims that the child’s biological father is not Joe, but her own husband Dan. You are the DNA technician who has been asked to perform genetic testing to determine the true biological father.

1. Review information about the process of genetic fingerprinting. You can perform an Internet search on the subject if you do not have other reference materials.

2. You have been given the following DNA samples:


Mary

CCTAGACGGCCAGGCACAAGCCAGGCCATGGCCACATCAGTTAGACCGAGGCCGAATCGGCCTTATTGCAGG


Joe

CCGAGGCCAGGGTATACCGGTATAGGCCAATTTGGCCGGCATGGGCCGATACAGCCGATGGCCATATAGGGGG


Dan

CCGGTACATTACCAGGCCAAGGATACGGCAAGCAGGCCTTCATGGCCAAGGCCTTAGCACGGGCCAATGACGG


Baby Jacob

CCACATCAGTTAGACCGAGGCCAAGGCCAACCGACGGCAAGGCCCGACAGGCCAAAGACGGCCATATAGGGGG

3. You have decided to use restriction enzyme Hae III to cut between the GG and CC of each GGCC sequence. (It does NOT remove the GGCC.) Show where the Hae III will cut the DNA. Use your mouse to move the lines to the right into the sequences above.

One cut has been done for you in Mary’s DNA as an example.

4. Since we know that the process of DNA fingerprinting will cause the restriction fragments in each sample to separate according to size, count the number of bases in each fragment. Then fill in the chart on page 2 by copy/pasting each fragment into the correct cell. This chart represents the “gel” that separates DNA by size.

The first restriction fragment produced in Mary’s DNA has been done for you as an example. It was placed in Mary’s column because it comes from Mary’s DNA. It was placed in Base row 9 because this restriction fragment contains 9 bases.

5. You have decided to use a probe that is a small piece of DNA with a sequence of “GTA” that has been labeled with radioactivity. This probe will attach to a section of DNA with the complementary code. What DNA sequence will your GTA probe attach to?

6. Using the Highlighter feature of your word processing program, highlight all of the sequences in the “gel” above that contain the complementary sequence determined in #5. These sequences will have the radioactive probe attached to them.

7.

8. After exposing an x-ray film to the gel, only the areas containing the radioactive probe will leave a cloudy area on the film. These are the same areas you just highlighted and they are known as “genetic markers.” We will now fill in the “film” to the right with gray blocks that represent our markers. They will be located in the same positions as the highlighted fragments above.

9. Remembering that all the markers found in Baby Jacob must be found in either Mary or the father, who will you say is the father of Mary’s baby?

10. If you were serving on the jury in this case, who would you choose to raise the baby? Why?







Place your order
(550 words)

Approximate price: $22

Calculate the price of your order

550 words
We'll send you the first draft for approval by September 11, 2018 at 10:52 AM
Total price:
$26
The price is based on these factors:
Academic level
Number of pages
Urgency
Basic features
  • Free title page and bibliography
  • Unlimited revisions
  • Plagiarism-free guarantee
  • Money-back guarantee
  • 24/7 support
On-demand options
  • Writer’s samples
  • Part-by-part delivery
  • Overnight delivery
  • Copies of used sources
  • Expert Proofreading
Paper format
  • 275 words per page
  • 12 pt Arial/Times New Roman
  • Double line spacing
  • Any citation style (APA, MLA, Chicago/Turabian, Harvard)

Our guarantees

Delivering a high-quality product at a reasonable price is not enough anymore.
That’s why we have developed 5 beneficial guarantees that will make your experience with our service enjoyable, easy, and safe.

Money-back guarantee

You have to be 100% sure of the quality of your product to give a money-back guarantee. This describes us perfectly. Make sure that this guarantee is totally transparent.

Read more

Zero-plagiarism guarantee

Each paper is composed from scratch, according to your instructions. It is then checked by our plagiarism-detection software. There is no gap where plagiarism could squeeze in.

Read more

Free-revision policy

Thanks to our free revisions, there is no way for you to be unsatisfied. We will work on your paper until you are completely happy with the result.

Read more

Privacy policy

Your email is safe, as we store it according to international data protection rules. Your bank details are secure, as we use only reliable payment systems.

Read more

Fair-cooperation guarantee

By sending us your money, you buy the service we provide. Check out our terms and conditions if you prefer business talks to be laid out in official language.

Read more

Get 15% OFF on your FIRST order. Use the coupon code: new15